Examplepictures of DNA-Structures

Gene Targeting Guide

content is not getting updated any longer. for newest developments in genome editing please see our recent publications. methods here are still of use and supply a general understanding of design.

Here we describe a way to design conditional alleles for mouse as well as practical hints for creating them. However, the strategies are transferable to other applications.

"For a knock out we want to cause the most disruption to the protein, with causing the least disruption to the gene (genome)."

The creation of the constructs is based on recombineering. Please also see our Recombineering Guide for practical hints on this method.

This guide is based on the ENSEMBL Release 59 (5 August 2010).

Last changes made: Feb 2012


1) Knock-out First Allele Constructs

Gene Targeting Guide for knock-out first allele constructs similar to: 

 

 

Image obtained from: http://www.knockoutmouse.org/about/view-all-ikmc-allele-types 

For a strategy overview of our Gene Targeting Pipeline, please see Section 15)

2) Gene of Interest

Looking at your gene ...

... in ENSEMBL (and UCSC)

Example: Ctr9 (ENSMUSG00000005609)

  • Note down gene names, accession number and other gene identifiers (location, protein features). 
  • Look up whether there is already a Knockout Cell Line or a Targeting Vector available on knockoutmouse.org
informationExample: Ctr9
strand?forwardpic1
different transcripts? -> usually go for the longest one (note down acc. #) 2, differ at the later exons pic1
exons?several (more than 2!)pic2
Havanna Genes (Location View -> configure this page -> genes -> display Havanna genes)Ctr9 longest transcript is Havanna confirmed
existing KO alleles (configure this page -> external data -> KO alleles)2 KO alleles for Ctr9 in the pipeline  (to learn more about the projects right click on it, you might consider ordering the targeted ES cells or the targeting vector from EUCOMM)pic3
existing KO designs (manage your data -> attach DAS -> Sanger -> check KO_designs)Many KO designs existing for Ctr9pic3
UCSCENSEMBL information confirmedpic4
strain variation for that gene (SNPs, etc.) nearly no differences between B6 and 129

3) Expression

Is the gene expressed in ES-cells? 
  • check genetrap.org for existing cell lines
  • expressed genes are suitable for promotorless targeting cassettes

Example: Ctr9 has 2 diff. genetraps (pic)

4) Exon Selection

 Selection of a target exon for a knock out construct
  •  view the exons of the transcript you have chosen as design basis (pic)
  • look for the most 5' exon that meets the following criteria
Exon selection criteria and example for Ctr9
Reason123456
frame shifting exon?(exon phases)deletion will lead to early stop codon  
nonoyesnoyes
exon present in all (translated) transcripts?otherwise possibility of function replacement by other protein product 


yes
yes
exon in first half of coding sequence?otherwise function might not get affected 


yes
yes
(exon coding for domain?)**esp. important if no frameshifting exon is available
 



yes
yes
flanking introns bigger than 500 bp[150 bp]*?to leave splice acceptors + donors intact 


no
yes
exon smaller than 2 kb?increasing distance of loxP-sites up and downstream of the exon, decrease the efficiency of recombination between themyes
(exon bigger than ~50 nt?)**very close SSR sites do not recombine well, and very small deletions might be without effectyes
5 kb upstream of the exon does not contain the gene's promotor region?for promotorless targeting 




yes
(at least 35 aa of the protein are made in the KO)**otherwise potential to re-initiate translationyes
no antisense genes in this regionotherwise affecting another gene by KOyes
(at least 55 bp from the PTC to the last splicing donor)**nonsense mediated decay (NMD) of the RNA is prohibited, so mRNA levels might be detectableyes

* 500 bp is the minimum size of flanking introns in the EUCOMM designs, 150 bp is usually enough to put a cassette without interruption of splice adaptors and splice donors (leave at least 50 bp from the splice donor, which is 5' end of the intron, and 100 bp from the splice acceptor, which is the 3' end of the intron)

** those criteria are taken in account by EUCOMM designers and are not the most important for us

  • note down exon identifier and position

Exceptions:

  • If flanking introns are too small or the exon itself is very small, try to knock out 2 sequential exons (check for frame shift again)
  • For one intron genes, put the downstream loxP-site into the 3' non-coding region or downstream of the polyadenylation signal.

5) Regulatory Elements and Repeats

Examination of the critical exon's environment
  • view chosen exon and at least 5 kb up and downstream in Location View (pic)
  • check for regulatory elements and repeats in this region
    ElementReasonHow to viewCtr9
    CpG-islandsplacing cassettes into CpG island can lead to silencing of the selection markers or altered expression of the geneEnsembl Location View -> Configure this page -> simple features -> CpG-islandswon't be hit by he cassettes
    Conservationconserved regions are a hint to regulatory elements that you do not want to hit with a cassette due to possible pleiotropic effectsEnsembl -> Configure this page -> Multiple alignments -> constrained elementsonly at the exons, so won't be hit by the cassettes
    Repeatsrepetitive sequence decreases the correct recombineering proportion when placing the cassettes or subcloning from the BAC, and repetetive regions at the homology arm ends might decrease the homologous recombination efficiency in ES cellsEnsembl -> Configure this page -> Repeats -> all repeatsenough distance from critical exon to put cassettes, homology arm end region also repeat-free
    HCNE (highly conserved nonconding elements)see conservationAncora browser -> give position and enable all HCNEsnone (pic)

    6) Oligo design

    • to define the positions of the cassettes as well as the homology arm length (by subcloning), you have to select oligos of 50 bp [70 bp]* which serve as homology arms in recombineering
    • to design those oligos you can use the
    • recheck also the G-oligos for not recombining in exons (if small deletions happen) and in CpG-island (chromosome structure might inhibit recombination)

    HTGT-tool

    • create an account under http://www.sanger.ac.uk/htgt 
    • use custom design tool
    • create a design for knock out first, block specified (means not fixed to specific bp)
    • set parameters (taking intron sizes, repeats, HCNEs, ... in account)

    changes of default for Ctr9 (pic)
         homology arm length: 5000 bp
         upstream spacer: 250 bp
     

    • insert Ensembl ID: ENSMUSG00000005609
    • select critical exon(s):  ENSMUSE00000203310
    • change comment line (otherwise your email address is visible with the designs in ENSEMBL)
    • Create&Run
    • note down ID 
    • click refresh or check for design by ID later (pic)
    • in case design failed or you want to change it, click Edit and change parameters as described above (you may delete the old design then)

    Manual Design

    • neccessary for non-mouse DNA, non-exon targeting or non-annotated genes
    • download gene sequence into your vector construction program
    • select the positions in the same distance from the critical exon as for the HTGT-tool
    • blast about 150 bp to the genome
    • find non-repetetive regions (exclude low complexity sequence)
    • check for around 50% GC content
    • (exclude hairpin formation etc. if software available)
    • decide on 50 bp* serving as oligo (homology arm for recombineering)

    *70 bp should be used for subcloning oligos.

    7) Annotation in a Vector Program

    Retrieving the sequence
    • click on critical exon to get it in the Ensembl location view
    • export data, add 20,000 bp flanking sequence on either side (necc. for southern design)
    • export as genbank file if you vector program has an import function for that
    • otherwise export as text and manually annotate
    • in case you used the HTGT tool you can also copy and paste the 15_E_15 sequence, which is exon plus 15 kb up and downstream sequence

    Annotation of the oligos in your file
    • mark the oligos in the genomic sequence
    • see where homology arms will end and which small intronic regions will be deleted by the cassette insertion (keep in mind for southern strategy)

    8) In-Silico Creation of the Targeted Allele

    Creation of the targeted allele
    • create a new file and place your cassettes
    • 1st cassette here: FRT-SA-GT1-T2A-lacZneo-CotC-FRT-loxP 
    • 2nd cassette here: rox-PGK-HYG-rox-loxP
    • ATTENTION: always check the orientation of the loxP-sites as different cassettes bring loxP-sites in different orientations. Only loxP sites that point in the same direction will give the intended deletions.

    9) Southern Strategy Design

    • early southern strategy design is recommended (certain designs may have no good possibilities for southern probes or enzymes and therefore have to be altered, best before practical work starts)
    • design the southern strategy by comparing wildtype allele to targeted allele
    Finding southern probes
    • blast about 1000 bp left of 5' homology end and right of 3' homology end to the mouse genome (set blast to "no filter")
    • find at least 500 bp continuous sequence without repeats and create primers in it, that give a PCR product of 500-700 bp (good southern probe size)
    • the closer the probe is next to the ends of the homology, the bigger is the chance to find good enzymes
    • probes that stretch over exons are favourable

    Finding restriction enzymes

                  that cut neither in the homology arms nor in the southern probes, meaning for the 5' southern you pick enzymes that do not cut in the region between the 5'fwd primer of the probe and oligo U5, and for the 3' southern enzymes that do not cut between oligo D3 and 3'rev primer of the probe (pic
                    that are not inhibited by eucaryotic methylation patterns (table)
                   that give a band (when hybridized with the labelled probe) of 5 to 15 kb
                   that give a size difference between WT and targeted allele of > 1kb

    • here: for 5' ScaI gives a band at 9888 bp for WT and 11881 bp for the targeted allele
    • have at least one alternative in case enzyme cuts unexpectedly
    • you may do double digests if no simple digest meets the criteria (check for enzyme buffer compatibility)
    • create a theoretical gel picture for the outcome of the southern (pic)
    • repeat all steps for the 3' southern

    If you cannot find nice probe regions or good enzymes, try to redesign the homology arms.

    10) Targeting Vector

     

    Creating the targeting vector in silico
    • copy the sequence between the homology arm ends from the targeted allele and paste it to the backbone 

    Linearisation Sites
    • check for restriction sites in the backbone for linearisation
    • use (combination of) restrictions sites that cut out backbone (example: SgrAI)
    • or insert a new restriction site into junction between homology arm and backbone on both sides (for using the counter selection marker on the backbone [TK/DTA] only on one side)
    • example for Ctr9: SalI (GTCGAC) or SnaBI (TACGTA)
    • note down on which side the counter selection marker will remain after digestions

    Oligos for ordering
    • get the complete sequence of the oligo by copying the 50/70 bp homology (designed by HTGT) plus the primer for cassette/backbone amplification
    • [please note that for subcloning by gap repair (see C in figure below), the sequences included in the oligonucleotides should be the inverse compliment to the orientations which are for insertions (see B in figure below)]
    • by copying it out of the final file, there is no chance of miscombining the 2 parts
    • do not forget to make the reverse complement of the downstream primer

    11) BACs for the Gene of Interest

    Important information

    -> Overview of mouse and human BAC libraries including informations about DNA origin, backbone and selection markers. 

    Finding a BAC and ordering it
    • we recommend to use UCSC to find BACs, as they only show end-sequenced BACs and have prooven by experience to be more reliable in the annotation (we rarely see BACs with the same name, having different length in the 2 browsers, especially for human)
    • to display the BACs:
    BAC LibraryGenome BrowserHow to DisplaySupplier
    RP23/RP24 (mouse)

    ENSEMBLLocation view -> Configure this page -> External data -> switch on BAC mapCHORI BacPac


    UCSCswitch on BAC End Pairs
    CH29 (mouse)ENSEMBLLocation view -> Configure this page -> Other DNA Alignments -> switch on CHORI-29 clones
    bMQ/129 (mouse)ENSEMBLLocation view -> Configure this page -> Other DNA Alignments -> switch on ens_m37_129AB22 
    SourceBioscience (Geneservice)
    RP11 (human)


    UCSCswitch on BAC End Pairs

    CHORI BacPac
    ENSEMBLLocation view -> Region overview
    CHORI BacPac
    Location view -> Region in detail -> Configure this page -> misc features -> switch on 32 k clone set (you may try using a different browser than Firefox)
    CH17 (human, w/o loxP sites)UCSCfollow the instructions by CHORI to add the CH17 track to UCSC
    other librariesUCSCcheck for instructions by CHORI to add your favourite library to the browser

     Example for Ctr9: RP23-463L18 (118,072,655-118,240,067)

     There is also a clone finder at NCBI, that reads out many more libraries. We have no experience with its completeness and reliabily though so far.

    You may also use the BACFinder 2.0, that is used by the Hyman lab for finding BACs for their pipelines.

    Features for a good BAC
     
    Creating the BAC map
    • when you have found the best BAC, right click on it and get its end points
    • export the sequence between this endpoints (for Ensembl: location view -> export data -> no flanking sequence)
    • this sequence is the insert sequence
    • if you want information about the BAC library backbones, see table or visit CHORI website
    • put the sequence into your vector construction program and annotate

     

    • create all intermediate files from the WT BAC file to final subclone according to the actual strategy in the lab
    • use these files to decide on enzymes for restriction analysis for the intermediate steps (detection of deletions or mixtures!)
    For ssOligo-experiments and backbone modifications (e.g. PiggyBac integration)

    ->Overview of backbone maps and replication orientation.

    12) Genotyping Primers

    What needs to be genotyped in the modified ES-cells/mouse?
    • checking for the presence of the 3' loxP (especially if it is a single loxP without selection marker)
    • checking for successfully Flped allele (loss of lacZneo-cassette)
    • checking for successfully knocked out allele (loss of critical exon)
    Where to design primers?
    • put primers into WT sequence and distinguish the WT from the targeted by size difference - in case of a heterozygous gene (+/-, +/F, ...) you will always get both bands
    • in case of low size difference or huge distance of primers, put an additional primer into the cassette/loxP and prove the existence of the cassette/loxP by getting a product

    make the primer longer than 21 nt and have 3 non-matching nt at the end with a C/G at the very 3' end

    13) Standard Cassettes and Alternatives

    trapping cassettes




    FRT-SA-IRES-lacZneo-pA-FRT-loxPreading frame independent trapping cassette (description see blow)
    loxP-FRT-SA-IRES-lacZneo-pA-FRTsame as above with different loxP position
    FRT-SA-IRES-lacZBSD-pA-FRT-loxPreading frame independent trapping cassette with different selection marker for second allele targeting
    FRT-SA-GT0/1/2-T2A-lacZneo-pA-CoTC-FRT-loxPreading frame specific versions of the trapping cassette with T2A (description see below)
    FRT-SA-IRES-BSD-pA-FRT-loxPreading frame independet trapping cassette with different selection marker for second allele (for constitutive knockout by deletion of critical exon)
    FRT-SA-IRES-lacZneo-PGKBSD-pA-FRT-loxPreading frame independent trapping cassette with additional promotordriven selection 
    3'loxP insertion cassettes







    loxP-PGKneo-loxPafter Cre expression single loxP remains
    loxP-zeo-loxPafter Cre expression single loxP remains
    cm-loxPafter digestions and religation single loxP remains
    rox-PGK-Em7-BSD-rox-loxPvehicle for 3' loxP (description see below)
    rox-PGK-Em7-HYG-rox-loxPvehicle for 3' loxP (description see below, alternative selection marker)
    backbones



    pBR322-ampmiddle copy minimal vector
    p15A-HSVtk-TK-ampmiddle copy vector with bacterial selection marker and eucaryotic counter selection marker
    p15A-HSVtk-DTA-ampmiddle copy vector with bacterial selection marker and eucaryotic counter selection marker

    Other useful selection cassettes can be obtained from Gene Bridges.

    Detailed description of the most important cassettes:

    FRT-SA-IRES-lacZneo-pA-FRT-loxP (Chen and Soriano, 2003)

    This stop cassette includes the Engrailed-2 splice acceptor to capture the transcript of the target gene. It is followed by an internal ribosome entry site (IRES) promoting the expression of a b-galactosidase-neomycin resistance fusion protein and a 3'-non-coding region ending in a polyadenylation signal. The neomycin resistance gene has an additional bacterial promotor (in frame). The cassette is flanked by FRT sites, allowing to restore gene function after the trapping by its removal via Flp expression. The loxP-site is unaffected by this recombination event.

    FRT-SA-GT0/1/2-T2A-lacZneo-pA-CoTC-FRT-loxP

    This cassette is the new version of the previous trapping cassette. The splice acceptor has been shortened and the IRES has been replaced by a 2A ribosomal-error peptide (Szymczak et al, 2004). This makes the cassette smalle but the absence of an IRES requires the cassette to be in frame with the exon upstream of it. Consequently the stop cassette has been made in three versions. During design, the correct version needs to be selected according to the 0,1 or 2 reading frame of the upstream exon. A second 2A peptide is included 3' of b-galactosidase, so that it is a separate protein from neomycin resistance, which enhances performance of both proteins compared to the fused version. In addition to the poly adenylation signal the cassette has a co-transcriptional cleavage site. The position of the FRT and loxP sites is as described. 

    rox-BSD-Em7-PGK-rox-loxP

     This cassette introduces the 3?loxP site into the 3?intron. It includes a PGK promoter driving the eucaryotic and an Em7 promotor driving the bacterial expression of the blasticidin resistance gene. For genes that are expressed in ES cells and can be targeted by selection of neomycin/G418 resistance driven from the endogenous target gene promoter (termed ?promoterless selection?), the rox cassette should be removed in E.coli by expressing Dre recombinase from pSC101-BAD-Dre (Anastassiadis et al, 2009) to leave the 3?loxP site in the targeting construct. However, in a few cases after targeting in ES cells, we have found that all targeted clones omit the 3?loxP site. In these cases, the targeting can be repeated using the construct including the rox cassette and selecting for both neomycin and blasticidin resistance to force the inclusion of the 3?loxP site. For genes that are not expressed in ES cells, the targeting construct must include a promoter to drive expression of the selectable gene. Here the rox cassette provides this function. In the cases when the rox cassette remains after targeting, it must be removed either by expressing Dre in ES cells or by crossing to a Dre deleter (Anastassiadis et al, 2009).

    p15A-HSVtk-DTA-amp

    The subcloning vector, p15A-HSKtk-DTA-ampR, is based on the p15A plasmid origin. Consequently it does not give the very high copy yields delivered by the mutated colE1 origins in pUC-type plasmids. We have found that these unnaturally very high copy plasmids can provoke recombineering problems, so prefer p15A or the unmutated colE1 origin from pBR322 for recombineering applications, particularly subcloning by gap repair. In p15A-pTK-DTA-ampR, the diptheria toxin A chain (DTA) coding region under the HSVtk promoter lies between the p15A origin and the ampicillin resistance gene. For subcloning, the vector is amplified by PCR to attach the homology arms. The presence of a DTA gene permits the use of positive/negative selection (Mansour et al, 1988; Yagi et al, 1990). We have found that negative selection can benefit promoter-driven selection but has little effect on promoterless selection. Therefore we recommend that the vector be entirely cut off for promoterless selection or linearized for promoter-driven selection.

    14) Link Collection

    Useful Links for In-Silico Genomics
    CategoryLinkPurpose
    Genome Browser



    ENSEMBL basis for designs
    UCSC additional information to ENSEMBL
    AncoraHCNE browser
    ENSEMBL (old version) based on NCBI m36 mouse assembly, for reference to old projects 
    VEGA
    Genome Engineering Databases

    International Gene Trap Consortium
    International Knockout Mouse Consortium
    EUCOMM (European Conditional Mouse Mutagenesis Program)
    BLAST tools




    Blast 2 sequences (NCBI)
    Megablast (NCBI)
    Blast against E.coli genome
    Blast against human genome (NCBI)
    Blast against mouse genomce (NCBI)
    BLAT (Ensembl)
    Genomic toolsHigh Troughput Gene Targeting (HTGT) tool (SANGER)Oligo design for targeting attempts
    DNA tools



    GeneMasterDNA nucleotide analysis, translation, reversion
    PlasmidMapperAnnotation help for fasta sequences
    In-Silico Primer Check (UCSC)Check primers for additional unwanted products when used with genomic DNA
    Primer Calculator (Sigma)Primer Analysis for T, structures, dimers
    Primer 3Primer Design for PCRs
    Enzyme tools

    Enzyme finder (NEB)for availability and features of enzymes
    Double digest finder (NEB)to check for condition compatibility of 2 enzymes
    Rebasealternative enzyme search
    BAC SuppliersCHORI BacPac
    Geneservice
    Oligo Supplier Biomersused by Stewart lab, any other supplier might be fine
    DNA prep SupplierInvitekusage see practical protocol
    Courses about Recombineering and Mouse Genome EngineeringPhD course for Recombineering
    SANGER Wellcome Trust Advanced CoursesGenetic Manipulation of ES cells
    Gene Bridges

    15) Practical Pipeline in E.coli

    Gene Targeting Pipeline for Standard Conditional Alleles 

    PCReactions and Cassette Preparation

    Three PCR products are required to generate the first allele targeting construct. 

    The first PCR product is amplified from the rpsL-gentamycin selectable/counterselectable cassette. The PCR amplified rpsL-gen cassette already contains the homology arms for the stop cassette (step 3). Consequently incorporation of the rpsL-gen cassette into the BAC by selection for gentamycin resistance incorporates the homology arms for the stop cassette. We include this step because it avoids PCR amplification of the 6.1kb stop cassette. Instead a restriction fragment from a pR6K-amp-lacZneo plasmid preparation is used, thereby reducing unwanted, PCR-based, mutagenesis. 

    The second PCR product is the amplification of the subcloning vector, p15A-pTK-DTA-ampR. 

    The third PCR product is amplified from the pR6K-PGK-BSD template, which will insert a loxP site on the 3? side of the chosen exon. 

    Primer sequences
    rpsL-gen 5?GCGTGTTTCGAGCATGTTTCTGCGTAGTGTCAGCTCATC* 
    rpsL-gen 3?GTGTCCATCATCCTGTAGGTGTAGACGACGACGAACAGAG*
    p15A-tkDTA-ampR 5? TTAATAAGATGATCTTCTTGAGATCG
    p15A-tkDTA-ampR 3?TTACCAATGCTTAATCAGTGAGG 
    PGK-BSD 5?TGACTACACCAAGGTGGAAGACAGAGAAAT 
    PGK-BSD 3?TCGTCACAATAATCTTCCACCGATCGCTTC

    *it is possible to shorten these oligos (however, do not shorten the amplified homology arms for the stop cassette)


    For further instructions concerning PCR conditions and the subsequent recombineering pipeline, please see our book chapters in Methods in Enzymology. 

    For plasmid requests, see here

    16) Selected Background Publications

    The following publications have been cited in our Enzymology Book Chapter about the Gene Targeting Pipeline. For further publications related to Gene Targeting, use of Site Specific Recombinases or Recombineering, please see our publications.

    Anastassiadis, K., Fu, J., Patsch, C., Hu, S., Weidlich, S., Duerschke, K., Buchholz, F., Edenhofer, F. and Stewart, A. F. (2009). "Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E. coli, mammalian cells and mice." Dis Model Mech 2: 508-15.

    Branda, C. S. and Dymecki, S. M. (2004). "Talking about a revolution: The impact of site-specific recombinases on genetic analyses in mice." Dev Cell 6: 7-28.

    Buchholz, F., Angrand, P. O. and Stewart, A. F. (1996). "A simple assay to determine the functionality of Cre or FLP recombination targets in genomic manipulation constructs." Nucleic Acids Res 24: 3118-9.

    Chen, W. V. and Soriano, P. (2003). "Gene trap mutagenesis in embryonic stem cells." Methods Enzymol 365: 367-86.

    Copeland, N. G., Jenkins, N. A. and Court, D. L. (2001). "Recombineering: a powerful new tool for mouse functional genomics." Nat Rev Genet 2: 769-79.

    Court, D. L., Sawitzke, J. A. and Thomason, L. C. (2002). "Genetic engineering using homologous recombination." Annu Rev Genet 36: 361-88.

    Datsenko, K. A. and Wanner, B. L. (2000). "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products." Proc Natl Acad Sci U S A 97: 6640-5.

    Ellis, H. M., Yu, D., DiTizio, T. and Court, D. L. (2001). "High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides." Proc Natl Acad Sci U S A 98: 6742-6.

    Filutowicz, M., McEachern, M. J. and Helinski, D. R. (1986). "Positive and negative roles of an initiator protein at an origin of replication." Proc Natl Acad Sci U S A 83: 9645-9.

    Glaser, S., Anastassiadis, K. and Stewart, A. F. (2005). "Current issues in mouse genome engineering." Nat Genet 37: 1187-93.

    Hamilton, C. M., Aldea, M., Washburn, B. K., Babitzke, P. and Kushner, S. R. (1989). "New method for generating deletions and gene replacements in Escherichia coli." J Bacteriol 171: 4617-22.

    Hashimoto, T. and Sekiguchi, M. (1976). "Isolation of temperature-sensitive mutants of R plasmid by in vitro mutagenesis with hydroxylamine." J Bacteriol 127: 1561-3.

    Ivics, Z., Li, M. A., Mates, L., Boeke, J. D., Nagy, A., Bradley, A. and Izsvak, Z. (2009). "Transposon-mediated genome manipulation in vertebrates." Nat Methods 6: 415-22.

    Mansour, S. L., Thomas, K. R. and Capecchi, M. R. (1988). "Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes." Nature 336: 348-52. 

    Poser, I., Sarov, M., Hutchins, J. R., Heriche, J. K., Toyoda, Y., Pozniakovsky, A., Weigl, D., Nitzsche, A., Hegemann, B., Bird, A. W., Pelletier, L., Kittler, R., Hua, S., Naumann, R., Augsburg, M., Sykora, M. M., Hofemeister, H., Zhang, Y., Nasmyth, K., White, K. P., Dietzel, S., Mechtler, K., Durbin, R., Stewart, A. F., Peters, J. M., Buchholz, F. and Hyman, A. A. (2008). "BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals." Nat Methods 5: 409-15.

    Ringrose, L., Chabanis, S., Angrand, P. O., Woodroofe, C. and Stewart, A. F. (1999). "Quantitative comparison of DNA looping in vitro and in vivo: chromatin increases effective DNA flexibility at short distances." EMBO J 18: 6630-41.

    Sarov, M., Schneider, S., Pozniakovski, A., Roguev, A., Ernst, S., Zhang, Y., Hyman, A. A. and Stewart, A. F. (2006). "A recombineering pipeline for functional genomics applied to Caenorhabditis elegans." Nat Methods 3: 839-44.

    Sauer, B. and McDermott, J. (2004). "DNA recombination with a heterospecific Cre homolog identified from comparison of the pac-c1 regions of P1-related phages." Nucleic Acids Res 32: 6086-95.

    Sawitzke, J. A., Thomason, L. C., Costantino, N., Bubunenko, M., Datta, S. and Court, D. L. (2007). "Recombineering: in vivo genetic engineering in E. coli, S. enterica, and beyond." Methods Enzymol 421: 171-99.

    Skarnes, W., Rosen, B., West, A., Koutsourakis, M., Bushell, W., Iyer, V., Cox, T., Jackson, D., Severin, J., Biggs, P., Thomas, M., Mujica, A., Harrow, J., Fu, J., Nefedov, M., de Jong, P., Stewart, A. and Bradley, A. (2010). "A conditional knockout resource for genome-wide analysis of mouse gene function." Nature in press.

    Szymczak, A. L., Workman, C. J., Wang, Y., Vignali, K. M., Dilioglou, S., Vanin, E. F. and Vignali, D. A. (2004). "Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector." Nat Biotechnol 22: 589-94.

    Testa, G., Schaft, J., van der Hoeven, F., Glaser, S., Anastassiadis, K., Zhang, Y., Hermann, T., Stremmel, W. and Stewart, A. F. (2004). "A reliable lacZ expression reporter cassette for multipurpose, knockout-first alleles." Genesis 38: 151-8.

    Testa, G., Zhang, Y., Vintersten, K., Benes, V., Pijnappel, W. W., Chambers, I., Smith, A. J., Smith, A. G. and Stewart, A. F. (2003). "Engineering the mouse genome with bacterial artificial chromosomes to create multipurpose alleles." Nat Biotechnol 21: 443-7.

    Valenzuela, D. M., Murphy, A. J., Frendewey, D., Gale, N. W., Economides, A. N., Auerbach, W., Poueymirou, W. T., Adams, N. C., Rojas, J., Yasenchak, J., Chernomorsky, R., Boucher, M., Elsasser, A. L., Esau, L., Zheng, J., Griffiths, J. A., Wang, X., Su, H., Xue, Y., Dominguez, M. G., Noguera, I., Torres, R., Macdonald, L. E., Stewart, A. F., DeChiara, T. M. and Yancopoulos, G. D. (2003). "High-throughput engineering of the mouse genome coupled with high-resolution expression analysis." Nat Biotechnol 21: 652-9.

    Wang, J., Sarov, M., Rientjes, J., Fu, J., Hollak, H., Kranz, H., Xie, W., Stewart, A. F. and Zhang, Y. (2006). "An improved recombineering approach by adding RecA to lambda Red recombination." Mol Biotechnol 32: 43-53.

    Wu, S., Wu, Y. and Capecchi, M. R. (2006). "Motoneurons and oligodendrocytes are sequentially generated from neural stem cells but do not appear to share common lineage-restricted progenitors in vivo." Development 133: 581-90.

    Wu, S., Ying, G., Wu, Q. and Capecchi, M. R. (2008). "A protocol for constructing gene targeting vectors: generating knockout mice for the cadherin family and beyond." Nat Protoc 3: 1056-76.

    Yagi, T., Ikawa, Y., Yoshida, K., Shigetani, Y., Takeda, N., Mabuchi, I., Yamamoto, T. and Aizawa, S. (1990). "Homologous recombination at c-fyn locus of mouse embryonic stem cells with use of diphtheria toxin A-fragment gene in negative selection." Proc Natl Acad Sci U S A 87: 9918-22.

    Yang, X. W., Model, P. and Heintz, N. (1997). "Homologous recombination based modification in Escherichia coli and germline transmission in transgenic mice of a bacterial artificial chromosome." Nat Biotechnol 15: 859-65.

    Yang, Y. and Seed, B. (2003). "Site-specific gene targeting in mouse embryonic stem cells with intact bacterial artificial chromosomes." Nat Biotechnol 21: 447-51.

    Yu, D., Ellis, H. M., Lee, E. C., Jenkins, N. A., Copeland, N. G. and Court, D. L. (2000). "An efficient recombination system for chromosome engineering in Escherichia coli." Proc Natl Acad Sci U S A 97: 5978-83.

    Zhang, Y., Buchholz, F., Muyrers, J. P. and Stewart, A. F. (1998). "A new logic for DNA engineering using recombination in Escherichia coli." Nat Genet 20: 123-8.

    Zhang, Y., Muyrers, J. P., Testa, G. and Stewart, A. F. (2000). "DNA cloning by homologous recombination in Escherichia coli." Nat Biotechnol 18: 1314-7.

    17) List of Abbreviations connected to Gene Targeting, Recombineering and Mouse ES Cells

    AMP        Ampicillin
     AOS        Array Oligo Selector
     ATG         Codon for the initiating methionine
     ATT         Gateway attachement site (attB, attP, attR, attL)
     BAC         Bacterial Artificial Chromosome
     bb         Backbone of a plasmid (origin of replication + selectable marker)
     BLAT         BLAST Like Alignment Tool
     BLAST         Basic Local Alignment Search Tool
     BSD         Blasticidin
     CCDS         Consensus CDS
     CDS         Coding sequence for rotein
     CE         Critical Exon
     CHORI         Children?s Hospital Oakland Research Institute
     CM         Chloramphenicol
     CNV         Copy Number Variant
     CoTC         Co-Translational Cleavage signal
     Cre         Site-specific recombinase from bacteriophage P1 genome
     CSD         CHORI, Sanger Institute, and UC Davis
     csm         Counter selection marker
     D         Downstream (oligo)
     DAS         Distributed Annotation System
     Dre         Phage D6 derived site-specific DNA recombinase
     EGFP         Enhanced Green Fluorescent Protein
     EJC         Exon Junction Complex
     EBI         European Bioinformatics Institute
     EMBL         European Molecular Biology Laboratory
     EMMA         European Mouse Mutant Archive
     ENCODE         Encyclopedia of DNA Elements
     EST         Expressed Sequence Tag
     EuCOMM         European Conditional Mouse Mutagenesis Program
     Flp         Site-specific recombinase from S.cerevisiae 
     Flpe         Flp, enhanced efficiency at 37 C = 
     Flpo         mammalian codon optimized, enhanced version of Flp
     FRT         Flp recombinase recognition target
     G         Gap repair (oligo)
     Gen         Gentamycin
     HA         Homology arm
     HGNC         HUGO Gene Nomenclature Committee
     Hprt         Hypoxantin phosphoribosyltransferase
     HR         Homologous Recombination
     HRP         Horseradish Peroxidase
     HUGO         Human Genome Organisation
     IGTC         International Gene Trap Consortium
     I-DCC         International Data Coordination Centre
     IKMC         International Knock Out Mouse Consortium
     IMMC         International Mouse Mutagenesis Consortium
     IMSR         International Mouse Strain Resource
     iPS cells         Induced pluripotent stem cells
     IRES         Internal Ribosome Entry Site
     KAN / KM         Kanamycin
     KO         Knock Out
     KOMP         Knock Out Mouse Project (USA)
     loxP         Locus of crossover (x) in P1 bacteriophage
     LR         Longe Range
     miRKO         micro RNA Knock Out
     MGH         Massachusetts General Hospital
     MGI         Mouse Genome Informatics
     MGNC         Mouse Genome Nomeclature Committee
     MGP         Mouse Genetics Program
     MM(R)RC         Mutant Mouse (Regional) Resource Centers
     MRC         Medical Resarch Council
     NCBI         National Center for Biotechnology Information
     neo         Neomycin/Kanamycin
     NIH         National Institute of Health
     NLS         Nuclear Localization Signal
     NMD         Nonsense-Mediated mRNA Decay
     NorKOMM         North American Conditional Mouse Mutagenesis project (Canada)
     OMIM         Online Mendelian Inheritance in Man (database)
     ori         Origin of replication
     pA         Polyadenylation signal
     PB         PiggyBAC (Transposon)
     PGK         promoter Phosphoglycerate kinase promoter
     PTC         Premature Termination Codon
     QC         Quality Control
     RE         Restriction Enzyme site
     RMCE         Recombinase-Mediaed Cassette Exchange
     RMGR         Recombinase-Mediaed Genomic Replacement
     rox         Dre specific recognition site
     RRS         Recombinase Recognition Site
     SB         SleepingBeauty (Transposon)
     SBP         Streptavidin Binding Protein/Peptide
     sm         Selectable marker
     SSR         Site Specific Recombinases
     Strep         Streptomycin
     TAP-tag         Tandem Affinity Purification
     TC         Targeting construct
     TET         Tetracycline
     TIGM         Texas Institute for Genomic Medicine
     U         Upstream (oligo)
     UCSC         University of California Santa Cruz
     UTR         Untranslated region
     VEGA         Vertebrate Genome Annotation
     WTAC         Wellcome Trust Advanced Courses
     WTSI         Wellcome Trust Sanger Institute
     

    Please contact us for any problems (content or function) of the Gene Targeting Guide.

    The author also disclaims accountability for the correctness of the given information and for the content of any external links.

    The author of this page wants to thank all lab members who helped with collecting this information, especially Jun Fu.

     

    To the top of this page.