BIOTEC - Biotechnology Center TU Dresden

Lecturer: Prof. Michael Schroeder (ms at biotec)
Tutor: Joachim Haupt (joachimh at biotec)

 Lecture: Thursday, 9.35?11.05, Biotechnologisches Zentrum (BIOTEC), E06.
Starting 27.10.2011
 Lab: Thursday, 11.10?12.40, Biotechnologisches Zentrum (BIOTEC), PC-Pool (E30).
Starting 27.10.2011 

Recommended Literature

• A. Lesk, Introduction to Bioinformatics, Oxford University Press. Chapter 1 is online. 
• A.M. Campbell et. al, Discovering Genomics, Proteomics & Bioinformatics

Slides from the lecture

• Org
• Introduction 
• Genomes 
• Web tour 
• Sequence comparison
• Protein Structure

Labs

• Lab 1:
  • Exercises as Electronic Questionnaire.
  • Linux and Bash Tutorial (German).
  • Translation Table at NCBI or Wikipedia
• Lab 2:
  • Exercises as Electronic Questionnaire.
• Lab 3:
  • Exercises as Electronic Questionnaire.
• Lab 4:
  • Exercises as Electronic Questionnaire.
• Lab 5:
  • Exercises as Electronic Questionnaire.
• Lab 6:
  • The Solutions for this lab will be available from Friday (2011/12/02) on!
  • Exercises as Electronic Questionnaire.
  • Question 4: Script, Input File
• Midterm Test on December, 8^th
  • 30 min in two groups
  • Group A: 11:20 to 11:50
  • Group B: 12:00 to 12:30
  • Material: only the Pool PC -- nothing else
  • Groups according to your first names in alphabetical order
  • Group A: first names 'A...' to 'Lis...'
  • Group B: first names 'Lui...' to 'Z...'
• Lab 7:
  • Exercises as Electronic Questionnaire.
  • submit before 2011/12/15!
• Lab 8:
  • Exercises as Electronic Questionnaire.
  • Do this lab together with Simone on 2012/01/05 during the normal lab time (not earlier)!
  • The Solutions for this lab will be available from Monday (2012/01/09) on.
  • Submit before 2012/01/09.
• Lab 9:
  • Back to the normal procedure...
  • Exercises as Electronic Questionnaire.
  • submit before 2012/01/12!
  • If the questions should exceed what you learned in the lecture, stop at this point. We'll do the rest in the lab.
• Lab 10:
  
  • Exercises as Electronic Questionnaire.
• Lab 11:
  
  • Exercises as Electronic Questionnaire.
• Lab 12:
  
  • We will do live exercises (including the local alignment from lab 11).
  • Exercises as Electronic Questionnaire.

Solutions:

• Solutions Page
• Scores Overview

• Lab 1:
  • Question 13 (thanks to Maria):
    AGTTTTCTTAGATTAGAAAATGTAGCCCATTTCTTTCCACTCCATAGGTT
• Lab 4:
  • Question 8:
    • Swiss-Model model: Result page, PDB file
    • Sequence for NP_828863.1: Fasta file
    • Proteinase structure of the human coronavirus strain 229E (template): PDB ID 1P9S

Exam

• 2012/02/15, 10:00 to 11:30 am, CRTD building Fetscherstraße 105, left lecture hall in the ground floor
• old exams (requires biotec login)
• Revision Class at 2012/02/09 16:00 to 17:30 in E05
  • prepare questions to ask!
  • inform Joachim about topics you want to discuss / you have questions about

Introductory materials:

 Before we start with the tutorial labs, you can already have a look at these useful materials:

• A short introduction to Linux . 
• Especially chapter IV is important for our purposes!
• Some linux basics for those who are more interested in Linux
• Python Resource
• Introduction to Bioinformatics by Arthur Lesk.
   You can read chapter 1 of the book here.